Everything the investigation has collected, in one place. Every exhibit except the one thing that names the organism.
This portfolio holds every piece of evidence in the case. The name of the organism is not in it, and that is deliberate. Five exhibits narrow the field. The sixth is the read you take to BLAST yourself.
Time: Open it at the start of the block and keep it open.
A patient record is the first evidence in any infection, and reading one in order, rather than hunting for the alarming line, is a clinical skill that takes practice. Read all of it before you decide anything.
Exhibit MI-1, the index patient record. This is the first person identified in a cluster of skin and soft tissue infections reported after a weekend sports tournament.
| Field | Recorded value |
|---|---|
| Age band | ('teenager',) |
| Presenting symptoms | ('painful red swollen area on the forearm, spreading redness, drainage, fever',) |
| Onset | ('3 days after a weekend tournament where equipment and towels were shared',) |
| Temperature | ('38.6 C',) |
| White cell count | ('elevated',) |
| Wound and blood culture | ('both positive at 24 hours',) |
| Rapid viral panel | ('negative for all targets tested',) |
| Stool ova and parasite exam | ('no ova or parasites seen',) |
| Fungal culture | ('no growth at 48 hours',) |
| Antibiotic susceptibility test | ('SENT, result not back yet',) |
Read the last four rows again. Four of the five classes of agent have a line in this record that argues against them. Finding those four lines is mini lab 1.
The curve is the population's version of a patient record. It shows what happened to everybody, which is the only way to see a shared exposure.
A Gram stain costs pennies and still changes the first antibiotic a hospital gives. That is why it is run before almost anything else.
A gel turns an invisible molecule into a distance you can measure with a ruler, and a distance anyone else can check is what makes a laboratory result evidence.
This read is the only exhibit that can name the organism, and it will only do it through a tool you drive yourself. That is not a trick. It is how identification actually works now.
Exhibit MI-6, one 500 base read of the 16S rRNA gene from the patient isolate.
>S2_practice_isolate 16S rRNA gene, one read of 500 bases GGCTCAGGATGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAACGGACGAGAAGCTTGCTTCTCTGATGTTAGCGGCGGACGGGTGAGTAACACGTGGATAACCTACCTATAAGACTGGGATAACTTCGGGAAACCGGAGCTAATACCGGATAATATTTTGAACCGCATGGTTCAAAAGTGAAAGACGGTCTTGCTGTCACTTATAGATGGATCCGCGCTGCATTAGCTAGTTGGTAAGGTAACGGCTTACCAAGGCAACGATGCATAGCCGACCTGAGAGGGTGATCGGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAACTCTGTTATTAGGGAAGAACATATGTGTAAGTAACTGTGCACATCTTGACGGTACCTAATCAGAAAGCCACGGCTAACTA
The organism this read belongs to is not named in this portfolio, in the packet, in the notebook, or on the portal. Run it through BLAST in SEC 06 of your packet.
| Class | What it is | Size | Seen on a Gram stain? | Grows on standard agar? | What it responds to | Typical onset | Example illnesses |
|---|---|---|---|---|---|---|---|
| Bacteria | One cell, no nucleus (prokaryote) | 0.5 to 5 micrometres | Yes, Gram stain shows them | Yes, on standard agar | Antibiotics, chosen by susceptibility | Hours to a few days | Strep throat, listeriosis, tuberculosis |
| Viruses | Genetic material in a protein coat, not a cell | 20 to 300 nanometres | No, far too small for a light microscope | No, they need living host cells | Antivirals. Antibiotics do nothing | One to fourteen days | Influenza, measles, COVID-19 |
| Fungi | Cells with a nucleus and a chitin cell wall | 2 to 10 micrometres (yeasts), longer threads (moulds) | Poorly. A KOH prep or a fungal stain is used | Yes, on fungal media such as Sabouraud agar | Antifungals | Days to weeks | Thrush, athlete's foot, histoplasmosis |
| Protozoa | One cell, with a nucleus (eukaryote) | 10 to 50 micrometres | Not by Gram. Seen on a stained smear or wet mount | Special media only, often not cultured at all | Antiprotozoal drugs | Days to weeks | Malaria, giardiasis, amoebic dysentery |
| Parasitic worms | Many cells, a whole animal (helminth) | Millimetres to metres | No. Eggs are found in stool under a microscope | Not cultured | Antiparasitic (antihelminthic) drugs | Weeks to months | Tapeworm, hookworm, roundworm |
| Organism | Class | First-line treatment | Prognosis and what it depends on | How it usually reaches people |
|---|---|---|---|---|
| Listeria monocytogenes | Bacterium | Ampicillin, often with gentamicin for severe or invasive disease | Dangerous in pregnancy, in newborns, over 65, and with a weakened immune system. Invasive disease is serious and treated in hospital. | Food-borne, including deli meats, soft cheeses and unwashed produce |
| Staphylococcus aureus | Bacterium | Depends entirely on the susceptibility test. Methicillin-sensitive strains take a beta-lactam such as cefazolin; MRSA does not, and is treated with drugs such as vancomycin | Ranges from a minor skin infection to life-threatening bloodstream infection. The susceptibility result changes the drug, so the lab result changes the prognosis. | Skin and nose carriage, wounds, healthcare contact |
| Streptococcus pyogenes | Bacterium | Penicillin or amoxicillin. Still reliably sensitive | Good with treatment. Untreated infection can lead to rheumatic fever, which is why a sore throat gets cultured. | Person to person by droplets |
| Pseudomonas aeruginosa | Bacterium | An antipseudomonal drug such as piperacillin-tazobactam or ceftazidime. Many ordinary antibiotics do not work | Often affects people already in hospital or with weakened defences. Resistance is common, so treatment follows the susceptibility test. | Water, moist surfaces and equipment |
| Salmonella enterica | Bacterium | Usually fluids and supportive care. Antibiotics are reserved for severe or invasive illness | Most healthy people recover. Antibiotics are not automatic, because they are not always helpful. | Food-borne, including poultry, eggs and produce |
| Escherichia coli, Shiga toxin-producing | Bacterium | Fluids and supportive care. Antibiotics are generally avoided, because they may raise the risk of a serious kidney complication | A case where the reflex answer is the wrong answer. This is why naming the organism matters before choosing a drug. | Food-borne, including undercooked beef and produce |
| Bacillus subtilis | Bacterium | Rarely causes disease in healthy people. Usually treated as an environmental or laboratory contaminant | A hit on this organism is more often a contamination question than a diagnosis. Check your controls before you check the drug chart. | Soil, dust and laboratory surfaces |
Claim ceiling. This table is a classroom reference for naming and reasoning. It is not a prescribing guide, it is not medical advice, and no one in this room diagnoses or treats anybody.
Table 1 is standard microbiology: cell structure, size ranges, staining behaviour, culture requirements and drug classes as described by the CDC and the National Library of Medicine. Table 2 follows CDC treatment guidance and standard clinical references for each named organism. Both are printed here as reference, not derived by students, which is why they sit in the index and not in a work section.
The isolate read in SEC 06 is a real 16S rRNA sequence. The identification it produces is produced by you, in BLAST, on the day. It is recorded nowhere in this packet.